COMPARING DNA SEQUENCES BETWEEN DIFFERENT SPECIES 2006-2014…!

Monday, June 9, 2014

COMPARING DNA SEQUENCES BETWEEN DIFFERENT SPECIES 2006-2014…!

COMPARING DNA SEQUENCES BETWEEN DIFFERENT SPECIES 2006-2014
UPDATING DATA SINCE 2006 and my Book of Pure Logic 2008…!

http://tinyurl.com/qhw547n
http://genome.cshlp.org/content/13/1/1.long
http://genome.cshlp.org/content/13/1/1/F2.expansion.html
http://www.ncbi.nlm.nih.gov/projects/sviewer/?id=NT_039700.8&v=747707..763274
http://www.ensembl.org/index.html

THERE ARE 409 OCCURRENCES MORE OR LESS OF THIS SEQUENCE TYPE in this
Assembly version of homo-sapiens (male) CHR-X:

“…ACACACACACACACACACACACACACACACACACAC…”

>gi|528471910|ref|NW_004929432.1| Homo sapiens chromosome X genomic scaffold,
alternate assembly CHM1_1.1, whole genome shotgun sequence:

CCCTCTGAAAGTGGACCAATCAGCAGGATGTGGGAGGGAGCAGATTAGAGAATAAAAGCAGACTGCCTGA
GCCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATACTGTGGAAGCTTCGTTCTTTCACTCTTTGCAATA
AATCTTGCTACTGCTCACTCTTTGGGTCCACACTGCCTTTCTGAGCTGTGACACTCACCGCAAAGGTCTG
CAGCTTCACTCCTGAGCCAGTGAGACCACAACCCCACCAGAAAGAAGAAACTCAGAACACATCTGAACAT
CAGAAGAAACAAACTCCGGACATGCCACCTTTAAGAACTGTAACACTCACCGCGAGGTTCCGCGTCTTCA
TTCTTGAAGTCAGTGAGACCAAGAACCCACCAATTCCAGACACACTAGGACCCTGAGACAACCCCTAGAG
GAGCACCTGGTCGATAACCCAGTTCCCATCTGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAGCTCC
TCATCTCTAACCCAGTTCCCCTGTGGGGATTTAGGGGACCAGGGACAGCCCGTTACATCAGCCCCTGGTC
TCTAACCCAGTTCCCTTCTGGAATTTAGGGGCCCTGGGACAGCCCTGTACATGAGCTCCTGGTCTGTAAC
ACAGTTCCCCTGTGGGGATTTAGGGACCTGGGCCTTCTGTCTTTGGGATCTACTCTCTATGGGCCACACA
GATATGTCTTCCAACTTCCCTACACAGGGGGGACTTCAAAGAGTGCCTTGAGCTGATCTGGTGATTGCTT
TTTTGTACTGTTATTTATCTTATTCTTTTCATTGTGAGGTACTGATGCAAACACTTTGTACGAAAAGGTC
TTTCTCAGCTCGGGAGTCCCCGTCTATTTGTCCCGGTCCCTGTTAACCCAGTCCCCGACAGGAGCCCCTT
CTGCACCTTGAGCTCTCACCACTCACCGTCCATCCAGCCCCAGCTCTGCCTGCAACCCACCCATCCCTGG
GACTCGGGCCTCCCCTCTCTAGTGGTCTGGTCATCAGGCCAGGGGCACGTGGAAGAAGCTATCGTGGCAA
AGGGAGCAGTCATATCCCCAAAATCTGTGGTTGTTTTACCACCACCATGGAAACCCCAGGGTGGGACTCT
AGTTTCAGGTTGGAGCTGAGCCCTGTCGGGAATGAGCTTTCCCCAGCTATGGCTTCTTGGGGCCCCTGTG
CCCTGAGCTGTGTCTCCCAGCATCGGGTCCCCACCATGCATATGGCCCACTCAGGCACAGTGCCGCGATG
GCTGCATGCGTGAGGGGGGCCTGGGCCCAGGGCTGGGAGTCCTTTGTGTCTCATGGCCATGATTGTCCTT
CCGAGTATGATATGGTGGCCAATTTCTTTTATTCTGTCGTTCAGAGTGAGTAAATGATGTAGAGTTCATG
CAGAAAAAAATACAACAAAAACCAAGGGAACATAGAATTGGAAAACGCGTCACAGCAATGAGTTAAATAG
GTAACAAATTTCATCATTTGAAGAAAGACTTAGAGTGCCAAAAGTGCCTCTTAAGTCTCCTTTAAAAAGT
AGCAAAATTCATCCCTGAAGAAGCATCTTGGCCTTTTTCATGTACTCAGAGTGCTGGTGAAGAACAAAGA
TTGCTGAAACATTATGTACCTAACAGCGTTACAGGGTGTAGATAACACACTGGAAAACCTGGTCGTTACA
GTGGACATATTCCAGGAAGTCCTTGCCTGAGGTTTTCCAAGTTATGGAATTGCTTGAGATTGGAAGAGGC
GATGGAGGGTACAACTGTAATGCCCAACCTCATTTTTGCTAACCCTGTTTTTAGACTCTCCCTTTCCTTC
AATCACCTAGCCTTCTTTCCACCTGAAAGGACTCTCCCTTAACTGAGAGAACCGGACAGACTCCATCTTG
GCTCCTTCACTGGCAGCCCCTTCCTCAAAGACTTAACTCGTGCAAGCTGACTCCCAGGACATCCGAGAAT
GCAATTAACTGACAACCTACTGTGGCGAGCTACATCCGCAGTCCCCAGGAATTCGTCCGATTGATAACGC
CCAATTACCCGCGTCTATCACCTTGTAATAGTCTTAAAGCACCTGCACCTGGAACTGTTTACTTTCCTGT
AACCATTTATCCTTTTAACATTTTGCCTAATTTACTTATGTAAAATTCTTTTAACTAGACCGCCACTCCC
CTTTCTAAACAAAAATATAAAAGAAAATCTAGCCCCTTCTTTGGGACTGAGACAATTTTGAGGTTAACGC
AGGGTGCCTGTAATCCTAAGGGAGGAGACCGCCACTTCTGCTGCCCCTCCCTTCCCCACACCCCCTTCTC
TAGTTTATGAAACAGGGAAAAAGGGAGAAAGCAAAAAGATAAAAAAAACAGAAGTAAGATAAATAGGTAG
ACGACCTTGGCAGCACCACCCGGCACTGGTGGTTAAAATAATAATAATAATAATATTAACCCCTGACCTA
AACTACTTGTGTTATCTGTAAATTCCAGACACTGTATGAGGAAGCCCTGCAAAACTTTCTGTTCTGTTAT
CTGATGCGTGTAGCCCCCAGTCACGTTCCGATGCTTCCTCGATCTATCACGACCCTTTCACGTGAACCCC
TTAGAGTCGTAAACCCTTAAAAGGGCCAGGAATTTCGTTTTCGGGGAGCTCGGCTCTTCAGGCCCAAGTA
AACCTGCCGTATCTCACCTGAGACCAACCCCCAACTACAAAACTCAACCTGGAATTTTCCCAGGACCAAA
CCCATCTATATTCTGTAACCCGAAACCTCAAAGCCTAACCCTAACCCTAACCCCTACAGTTGAGGTCCCC
CCGCCCCTGTGGTTCCAGCTCAAGACAACCTGCCCCTCCGTGGGTTTGCAGGCCCTCTGGTGGGGGTGGG
AGCTGGGGGCCACATACAGCTCTCTGAGCTTAAGCCATTTTCTTCCTTCATTCCTTCCTTCCTCCCTCCC
TTCCCTTCCTTCCTCCCTCCCTCCCTCCTTCCCTCCCTCCCTTTTTTTTTTCAGGGTCTTGCTCTGTCAC
CCAGGCTGGAGTGCAGTGGCATGATCACAGCTGACTGCAGCCTCGGACTCCCAGGCTCAAGTTATCTTCC
CTCCTCAGCCTCCAGAGTAGGTGGGACTACAGGAGTGTGCCATTGCACCCAGCGAATTTCTTAATTTTTA
TTTTGTAGAGATGAGGCCTCTCGATATTGTCCAGGCTTGGAAGTAGTTCTTGAAATTCAAGAGGATCTTG
AAGTTCTGACCTCCTGTCAATATCCCTTCCCCTCACCTTGACCCTCCCATTCTGCCCCACCTGTCAGGAT
CACAAGGACCCCCAGATCAGCAGATGGGAACCGGACCAAAAAGAGAAATAGTGCTGTCCCGCCCATAAGT
ACCACCCCCAGACTCCCTGCTCCACCCTCTGGACCACAGGGAGGCCCCATGCTCCATCCCTGAAAACCAC
CCCCAGACTCCCTGCTCCTCCCCACGGGACCGCCCCCAGATCCACTGTTCCTGTCCTCCGGACCACACCG
GACAGCTCCTTCCCTCGGCGCCATCCCCAGACCCCAGCTCCTCCCCTCAGGATCATCCCCAGACCCCCGC
TCCTCCCCTAAGGACCACCCACAGACCCCCACGCTTCCCCTCGGGATCACCCCCAGACCCCCGCTCCTCC
CATCAGGACCGCCCCCAGAACCCCCTGCTCCTCCCCACAGGACCACCCCCAGACCCCCGCTCCTCCCCTA
AGGACCACCCACAGACCCCCACGCTTCCCCTCGGGACCACCCCCAGACCCCCGCTCCTCCCATCAGGACC
ACCCCCAGATCCACTGTTCCTGTCCTCCGGACCACACCAGACAGCTCCTTCCCTCGGCGCCATCCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CCCGCTCCTCCCCTCGGGACCACCCCCAGACCCCCTGCTCCTCCCCACGAAACCACCCCCAGACTCCCTG
CTCCTGTCCTCCGGACCACGCGACTGCTCCTTCCCTCAGCGCCACCCCCAGACTGCCGCTCCTCCTGTCG
GGACCCCCTTCGGGCCACCTCCAGACCCTACCCCCGGTACACCCCTCGGGTCCCTCTCGGAACCATCCCC
AGACGCTCGCTCCTCCCCTCGGAACCCCCTCGCCGCCACCCCCAGACCCCCGCTCCTTCCCTTGGGATCA
CCTCGAGACCTCCCGCTCACCACCATCATTCAGGCCGGGTAGTGGGGAGAGGCCTCTCAGGAGGGACCAG
GCCACTCTCCCAGGAGTGAAGGGAGGAGGACAGAGTCA…………………………………..

http://tinyurl.com/qhw547n
http://genome.cshlp.org/content/13/1/1.long
http://genome.cshlp.org/content/13/1/1/F2.expansion.html

[[[“…
The present ability to sequence almost entire genomes outpaces in some aspects current computational and experimental methods to decode the information contained within these sequences. The existing high-throughput sequence annotation pipelines combine the results of database similarity searches and gene-predicting algorithms to identify coding sequences with good but not complete accuracy. In some cases only a fraction of the sequences comprising a gene are identified and some genes are missed entirely. Moreover, current annotation methods are largely unable to identify reliably other types of functional elements, such as transcriptional regulatory regions, noncoding RNA genes, and elements involved in chromosome structure and function.

Comparing the DNA sequences of different species is a powerful method for decoding genomic information, because functional sequences tend to evolve at a slower rate than nonfunctional sequences. By comparing the genomic sequences of species at different evolutionary distances, one can identify coding sequences and conserved noncoding sequences with regulatory functions, and determine which sequences are unique for a given species. Here we review the basis for selecting DNA sequences of species at appropriate evolutionary distances for comparative analysis depending on the biological question being addressed, and describe the algorithms commonly used in these studies. We also compare a small interval of human chromosome 7q31 with DNA sequences of four species at different evolutionary distances to demonstrate the multistep process of comparative sequence analysis, and discuss several of the public resources available for these studies.

Previous comparative DNA sequence studies have revealed that genes similar to each other at the nucleotide level can be related to one another by different evolutionary histories. Although a few examples of convergent evolution (two previously unrelated genes that became similar as they acquired new, related functions) have been reported, most comparative genomic approaches investigate sequences that are related by divergent evolution from a common ancestor. Genes derived from a common ancestral gene are homologs, and the level of similarity in their sequences often reflects the time since they diverged. Homologous genes can be generated by speciation, which produces pairs of orthologs (genes in different species that are derived from the same gene in the last common ancestral species, and thus usually have similar functions). Homologous genes can also result from the duplication of a chromosomal segment, which producesparalogs (duplicate gene pairs that have diverged and typically have different functions).

When performing cross-species DNA sequence comparisons to identify functional elements, it is important to distinguish between orthologous sequences and paralogous sequences. Comparisons between paralogs that are descended from last common ancestral species do not reveal as many evolutionarily conserved sequences as comparisons between orthologs, simply because those paralogous sequences have been apart longer, and thus are more divergent.
…”]]]
____________________________________________________________

….as of “today” anything denoted as the letter “N” has not been “determined”…!

the why ? i do not know directly, other than the logic main reason…!

to all that study the human genome from “SCIENCE” and “USA.gov” you can believe in SANTA CLAUS ALSO…!

Why?  because rain-deers are true but do not fly…! sleighs are real but do not fly either! And Santa Claus is only real as real you can touch one!

We have a clear confession that species similarities and “equal DNA sequencing” is only at the level of genes mainly !
BUT OF COURSE MOST “EMBRYOS” LOOK SIMILAR AT AND UP TO A FEW WEEKS”…! WE ALL ARE FLESH, BONES, BRAIN, NERVES, ORGANS, SKIN, ETC…!

SO FOLKS ! Keep on enjoying Pure Logic…! We have not left the dark middle ages of the Bible only being read in LAtin and by the RICH…!
Nooo…! We are in the 21st. Century Modern Dark Ages…!

.
.
.
Bookmark and Share

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s